How do I use a WeightMatrix to find a motif?

A Weight Matrix is a useful way of representing an alignment or a motif. It can also be used as a scoring matrix to detect a similar motif in a sequence. BioJava contains a class call WeightMatrix in the org.biojava.bio.dp package. There is also a WeightMatrixAnnotator which uses the WeightMatrix to add Features to any portion of the sequence being searched which exceed the scoring threshold.

The following program generates a WeightMatrix from an aligment and uses that matrix to annotate a Sequence with a threshold of 0.1

```java import java.util.*;

import org.biojava.bio.dist.*; import org.biojava.bio.dp.*; import org.biojava.bio.seq.*; import org.biojava.bio.symbol.*;

public class WeightMatrixDemo {

 public static void main(String[] args) throws Exception{
   //make an Alignment of a motif.
   Map map = new HashMap();
   map.put("seq0", DNATools.createDNA("aggag"));
   map.put("seq1", DNATools.createDNA("aggaa"));
   map.put("seq2", DNATools.createDNA("aggag"));
   map.put("seq3", DNATools.createDNA("aagag"));
   Alignment align = new SimpleAlignment(map);

   //make a Distribution[] of the motif
   Distribution[] dists =
       DistributionTools.distOverAlignment(align, false, 0.01);

   //make a Weight Matrix
   WeightMatrix matrix = new SimpleWeightMatrix(dists);

   //the sequence to score against
   Sequence seq = DNATools.createDNASequence("aaagcctaggaagaggagctgat","seq");

   //annotate the sequence with the weight matrix using a low threshold (0.1)
   WeightMatrixAnnotator wma = new WeightMatrixAnnotator(matrix, 0.1);
   seq = wma.annotate(seq);

   //output match information
   for (Iterator it = seq.features(); it.hasNext(); ) {
     Feature f = (Feature)it.next();
     Location loc = f.getLocation();
     System.out.println("Match at " + loc.getMin()+"-"+loc.getMax());
     System.out.println("\tscore : "+f.getAnnotation().getProperty("score"));
   }
 }

} ```