How do I display Features?

Features are displayed by implementations of the FeatureRenderer interface. FeatureRenderers work in much the same way as SequenceRenderers and handle the drawing of the Features from a Sequence that is held in a SequenceRenderContext.

A SequenceRenderContext has no way of interacting directly with a FeatureRenderer so a FeatureBlockSequenceRenderer is used to wrap up the FeatureRenderer and act as a proxy.

The use of a FeatureBlockSequenceRenderer and a FeatureRenderer is demonstrated in the program below. A screen shot follows the program.

[frame

center

Features in a GUI](image:Featview.jpg “wikilink”)

```java import java.awt.*; import java.awt.event.*;

import javax.swing.*;

import org.biojava.bio.*; import org.biojava.bio.gui.sequence.*; import org.biojava.bio.seq.*; import org.biojava.bio.symbol.*;

public class FeatureView extends JFrame {

 private Sequence seq;
 private JPanel jPanel1 = new JPanel();

 private MultiLineRenderer mlr = new MultiLineRenderer();
 private FeatureRenderer featr = new BasicFeatureRenderer();
 private SequenceRenderer seqR = new SymbolSequenceRenderer();
 private SequencePanel seqPanel = new SequencePanel();
 //the proxy between featr and seqPanel
 private FeatureBlockSequenceRenderer fbr = new FeatureBlockSequenceRenderer();

 public FeatureView() {
   try {
     seq = DNATools.createDNASequence(
         "atcgcgcatgcgcgcgcgcgcgcgctttatagcgatagagatata",
         "dna 1");

     //create feature from 10 to 25
     StrandedFeature.Template temp = new StrandedFeature.Template();
     temp.annotation = Annotation.EMPTY_ANNOTATION;
     temp.location = new RangeLocation(10,25);
     temp.source = "";
     temp.strand = StrandedFeature.POSITIVE;
     temp.type = "";

     //create another from 30 to 35
     Feature f = seq.createFeature(temp);
     temp = (StrandedFeature.Template)f.makeTemplate();
     temp.location = new RangeLocation(30,35);
     temp.strand = StrandedFeature.NEGATIVE;
     seq.createFeature(temp);

     //setup GUI
     init();
   }
   catch(Exception e) {
     e.printStackTrace();
   }
 }

 public static void main(String[] args) {
   FeatureView featureView = new FeatureView();
   featureView.pack();
   featureView.show();
 }

 /**
  * initialize GUI components
  */
 private void init() throws Exception {
   this.setTitle("FeatureView");
   this.getContentPane().add(jPanel1, BorderLayout.CENTER);
   jPanel1.add(seqPanel, null);

   //Register the FeatureRenderer with the FeatureBlockSequenceRenderer
   fbr.setFeatureRenderer(featr);

   //add Renderers to the MultiLineRenderer
   mlr.addRenderer(fbr);
   mlr.addRenderer(seqR);

   //set the MultiLineRenderer as the SequencePanels renderer
   seqPanel.setRenderer(mlr);

   //set the Sequence to Render
   seqPanel.setSequence(seq);

   //display the whole Sequence
   seqPanel.setRange(new RangeLocation(1,seq.length()));
 }

 /**
  * Overridden so program terminates when window closes
  */
 protected void processWindowEvent(WindowEvent we){
   if (we.getID() == WindowEvent.WINDOW_CLOSING) {
     System.exit(0);
   }
   else {
     super.processWindowEvent(we);
   }
 }

} ```